Basic Information


ANNInter ID ANNInter57890
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr000507 URS00023FF943_3702
Category tsRNA lncRNA
Coordinate 3:4649324-4660615(+)
Interaction Sequence ACCUACUUAACUCAGUGGUUA UAAUUACUGAGUUAAGUGGGU
Interaction Site 1 - 21 4730 - 4750

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network