Basic Information
| ANNInter ID |
ANNInter57067 |
| Interaction Type |
tsRNA - lncRNA |
| Identification Method(s) |
RNAhybrid;IntaRNA |
Interaction Information
| Type |
ncRNA Interactor 1 |
ncRNA Interactor 2 |
| ncRNA ID |
ath_tsr000283 |
URS0000A77367_3702 |
| Category |
tsRNA |
lncRNA |
| Coordinate |
|
3:7794956-7796326(+) |
| Interaction Sequence |
AUCCCUCCUCGCCCACCA |
UGGUGGGUGGUUUAGGGUGGGGU |
| Interaction Site |
2 - 19 |
1014 - 1036 |
Additional Information
| Unpaired Energy (UPE) |
NA |
| Inhibition Mode |
NA |
| RNAhybrid MFE |
-33 |
| IntaRNA MFE |
-25.72 |
| Degradome Support |
No |
| Allen's Score |
NA |
| Category |
NA |
| Sample IDs |
|