Basic Information
| ANNInter ID | ANNInter55342 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-9663 | ath_circ_005728 |
| Category | siRNA | circRNA |
| Coordinate | 3:17413850-17415548(.) | 1:13071964-13072582(+) |
| Interaction Sequence | AGAAGCCGC-AUAGUAAACUGGAAU | AUUCCAGGUUACUAUUGUGGUUUCU |
| Interaction Site | 1 - 24 | 313 - 337 |