Basic Information
| ANNInter ID | ANNInter54407 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-9344 | URS0002351253_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 3:16099859-16100157(.) | 1:553746-590945(+) |
| Interaction Sequence | GAAAUACAGGUAGU--CCAAAAACUC | AAGUUUUUGGUGAUUGCUUGUGUUUC |
| Interaction Site | 1 - 24 | 34890 - 34915 |