Basic Information
| ANNInter ID | ANNInter54137 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-9246 | ath_circ_050413 |
| Category | siRNA | circRNA |
| Coordinate | 3:15720001-15720762(.) | Pt:84086-94358(.) |
| Interaction Sequence | AGAAG-AACUUUGACAGAAAAGCCU | UUCUUUUUUUGUCCAAGUUACUUCU |
| Interaction Site | 1 - 24 | 5036 - 5060 |