Basic Information
| ANNInter ID | ANNInter53579 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-9061 | ath_circ_035019 |
| Category | siRNA | circRNA |
| Coordinate | 3:14329382-14334109(.) | 4:17179243-17180805(-) |
| Interaction Sequence | AGUGUGACGGUUUCUG-UGUGAUUC | GAAUCACAGUAGAAACCGUUACAUG |
| Interaction Site | 1 - 24 | 464 - 488 |