Basic Information


ANNInter ID ANNInter52814
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-9014 URS0002417BFC_3702
Category siRNA lncRNA
Coordinate 3:14179957-14181471(.) 5:12849750-12869285(+)
Interaction Sequence ACGGAAAGCCCAAAGAGAGCUCUC GAGGGCUCUCUUUGGGCUUUACGA
Interaction Site 1 - 24 6630 - 6653

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network