Basic Information
| ANNInter ID | ANNInter49991 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-8907 | ath_circ_024446 |
| Category | siRNA | circRNA |
| Coordinate | 3:13709711-13713071(.) | 3:14141584-14229094(.) |
| Interaction Sequence | GUGCUUGGGCGAGAGUAGUACUAGA | CCUAGUACUACUCUCGCCUAAGCAC |
| Interaction Site | 1 - 25 | 78639 - 78663 |