Basic Information
| ANNInter ID | ANNInter49907 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-8907 | URS0002417BFC_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 3:13709711-13713071(.) | 5:12849750-12869285(+) |
| Interaction Sequence | GUGCUUGGGCGAGAGUAGUACUAGA | CCUAGUACUACUCUCGCCCAAGCAC |
| Interaction Site | 1 - 25 | 12504 - 12528 |