Basic Information


ANNInter ID ANNInter49570
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-8897 URS000235E7DF_3702
Category siRNA lncRNA
Coordinate 3:13689642-13690267(.)
Interaction Sequence ACCGAAAUGUAUUUUUUCUGGCCU UUGGCGGGGAAAAUAAAUUUUGGU
Interaction Site 1 - 24 39926 - 39949

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network