Basic Information
| ANNInter ID | ANNInter48927 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-8744 | URS00023ADD34_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 3:12538050-12550156(.) | 2:4225748-4317670(+) |
| Interaction Sequence | AAUGAAGGUGAAGAC--ACUCGGCCU | UAGACGAGUUUGUUAUCAUCUUCAUU |
| Interaction Site | 1 - 24 | 14902 - 14927 |