Basic Information


ANNInter ID ANNInter48566
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-864 URS00023B9F96_3702
Category siRNA lncRNA
Coordinate 4:3971450-3971686(.) 1:24469064-24473567(+)
Interaction Sequence AGGAUAAGAUUGCGGUUUAAGUUC CAACUCAAACCGUGAUCUUAAUCU
Interaction Site 1 - 24 2818 - 2841

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network