Basic Information


ANNInter ID ANNInter48334
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-8567 URS00023ED2C4_3702
Category siRNA lncRNA
Coordinate 3:11587104-11589007(.) 1:24700051-24706940(+)
Interaction Sequence UCUGAAUGAACCGUUUUUGGCACC GGUGCCAAAAACGGUUCAUUCAGA
Interaction Site 1 - 24 5003 - 5026

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network