Basic Information


ANNInter ID ANNInter48006
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-8463 URS00023B27DC_3702
Category siRNA lncRNA
Coordinate 3:11098324-11101580(.) 3:10425087-10470193(+)
Interaction Sequence GUGAGAAAUCCGGACUGUAUAAUC UCUGUUAUAGUCCUGAUUUCUCAC
Interaction Site 1 - 24 44908 - 44931

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Translation
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network