Basic Information
| ANNInter ID | ANNInter47800 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-8389 | URS0002358C5D_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 3:10842090-10843491(.) | 3:10805291-10852119(+) |
| Interaction Sequence | AGCCGAUCCGAACCUG-ACUCGAAU | UUUUGGGUUCGGGUUCGGGUCGGUU |
| Interaction Site | 1 - 24 | 37571 - 37595 |