Basic Information


ANNInter ID ANNInter47711
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-8359 URS0002399058_3702
Category siRNA lncRNA
Coordinate 3:10751074-10752582(+) 2:711252-733121(+)
Interaction Sequence GGGGAUGUAGCUCAGAUGGU ACCAUCUUAGCUGCAUCUUG
Interaction Site 1 - 20 18513 - 18532

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network