Basic Information


ANNInter ID ANNInter47688
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-8353 URS0002409AE9_3702
Category siRNA lncRNA
Coordinate 3:10719072-10720539(.)
Interaction Sequence UGUCAAAUUUUUAUGGUCGUUGUU AAAAACCGCUAUGAAAACUUGGCA
Interaction Site 1 - 24 114236 - 114259

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network