Basic Information


ANNInter ID ANNInter46682
Interaction Type siRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-7991 ath_circ_041236
Category siRNA circRNA
Coordinate 3:8894357-8895558(.) 5:14404906-14463807(.)
Interaction Sequence AUACGCGAGUACGAUGGAAGUGUG CAUACUUCCACCGUACUCGCGUAU
Interaction Site 1 - 24 24922 - 24945

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network