Basic Information


ANNInter ID ANNInter46325
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-7838 URS00023E420C_3702
Category siRNA lncRNA
Coordinate 3:8100970-8101372(-)
Interaction Sequence AAAGAUGAAGAGAGAGAGAGGUA GUUCUCUUUCUCUCUUCAUUUUU
Interaction Site 1 - 23 25242 - 25264

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network