Basic Information


ANNInter ID ANNInter46194
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-7788 URS000234B5C3_3702
Category siRNA lncRNA
Coordinate 3:7880655-7881208(.) 4:11792317-11852541(+)
Interaction Sequence AUACAUCCCCGGAAACUAAAGCGA UUGGAGGAGUUUCCGGGGGUGUGU
Interaction Site 1 - 24 53023 - 53046

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network