Basic Information
| ANNInter ID | ANNInter45769 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-7651 | ath_circ_024251 |
| Category | siRNA | circRNA |
| Coordinate | 3:6770993-6772578(.) | 3:10822825-10993675(.) |
| Interaction Sequence | GAACGGGU-CUAAACUUCAAAACCU | GGGUUUAGAAGUUUAGGACCCGUUU |
| Interaction Site | 1 - 24 | 19704 - 19728 |