Basic Information


ANNInter ID ANNInter45612
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-7587 URS0002409AE9_3702
Category siRNA lncRNA
Coordinate 3:6268861-6269226(+)
Interaction Sequence AACGGAACAUGAGAGGGAAAAGAA UCCUUUUUCAUCUCGUGUUCUGUU
Interaction Site 1 - 24 34513 - 34536

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network