Basic Information


ANNInter ID ANNInter45333
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-7471 URS0002376853_3702
Category siRNA lncRNA
Coordinate 3:5584428-5584975(.) 1:7453566-7546337(+)
Interaction Sequence GAAGCUAGAAGAUCGACAGGAUA UUUUUUGUUGAUCUGCUAGCUUA
Interaction Site 1 - 23 52104 - 52126

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network