Basic Information


ANNInter ID ANNInter45227
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-7429 URS00023912CE_3702
Category siRNA lncRNA
Coordinate 3:5328392-5329056(.) 3:18202499-18269205(+)
Interaction Sequence ACUAGAGACUACUGAUGGAGAUGU ACGUUUCCAUUAGUAGUUUAUCGG
Interaction Site 1 - 24 32221 - 32244

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network