Basic Information


ANNInter ID ANNInter44298
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-703 URS0002397624_3702
Category siRNA lncRNA
Coordinate 4:2695540-2697187(.) 4:2672354-2717460(+)
Interaction Sequence ACGGAUCUCAUCACUGAAAACAGA UCUGUUUUCAGUGAUGAGAUCCGU
Interaction Site 1 - 24 23495 - 23518

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network