Basic Information
| ANNInter ID | ANNInter43357 |
|---|---|
| Interaction Type | MIRNA - lncRNA |
| Identification Method(s) | CleaveLand4 |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-6611 | URS00023647D7_3702 |
| Category | MIRNA | lncRNA |
| Coordinate | 2:19414958-19415242(+) | 1:11164499-11215986(+) |
| Interaction Sequence | UUAGAUUCACGCACAAACUCG | GGAGUUUGUGCGUGAAUCUAA |
| Interaction Site | 1 - 20 | 20726 - 20745 |
Additional Information
| Unpaired Energy (UPE) | NA |
|---|---|
| Inhibition Mode | Cleavage |
| RNAhybrid MFE | NA |
| IntaRNA MFE | NA |
| Degradome Support | Yes |
| Allen's Score | 1 |
| Category | 0 |
| Sample IDs | SRR17487780; SRR3956083 |