Basic Information
| ANNInter ID | ANNInter43001 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | CleaveLand4 |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-6481 | ath_circ_041194 |
| Category | siRNA | circRNA |
| Coordinate | 2:18355104-18355488(.) | 5:14119521-14121448(-) |
| Interaction Sequence | AUGGAGUAAACAAAGAAGGUG | GUCUUUUUUUGUUUACUCCAA |
| Interaction Site | 2 - 19 | 1705 - 1722 |
Additional Information
| Unpaired Energy (UPE) | NA |
|---|---|
| Inhibition Mode | Cleavage |
| RNAhybrid MFE | NA |
| IntaRNA MFE | NA |
| Degradome Support | Yes |
| Allen's Score | 4 |
| Category | 0 |
| Sample IDs | SRR19454926 |