Basic Information


ANNInter ID ANNInter41599
Interaction Type siRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-5887 ath_circ_050406
Category siRNA circRNA
Coordinate 2:13886317-13886623(.) Pt:82960-83040(-)
Interaction Sequence ACAGGACGAGUUGGCGGGACGGGU UUCUUUUCCGUCGAUACGUCCUGC
Interaction Site 1 - 24 8 - 31

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network