Basic Information


ANNInter ID ANNInter41369
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-579 URS00023957B5_3702
Category siRNA lncRNA
Coordinate 4:2182679-2189190(+) 1:21761604-21793814(+)
Interaction Sequence GAUGAGACUAGUGGAUGUGAGGGA UCUCCCACUUUCGUUAGUCUCAUC
Interaction Site 1 - 24 24480 - 24503

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network