Basic Information


ANNInter ID ANNInter41016
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-5627 URS00023BD39E_3702
Category siRNA lncRNA
Coordinate 2:12136452-12137061(.) 1:12024439-12104496(+)
Interaction Sequence AAACUGAGAAGUCGCAUGGAUUAC UUGUUCCAUGUGUCUUCUCAGUUU
Interaction Site 1 - 24 57719 - 57742

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network