Basic Information
| ANNInter ID | ANNInter40484 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-5431 | ath_circ_050396 |
| Category | siRNA | circRNA |
| Coordinate | 2:10879227-10879572(.) | Pt:80014-84545(.) |
| Interaction Sequence | AUGGAAAUCUGACA--UUGUGGUAUC | UGUAUCAUAACAUGUUAGAUUUCUGU |
| Interaction Site | 1 - 24 | 3487 - 3512 |