Basic Information


ANNInter ID ANNInter40480
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-5430 URS00023E420C_3702
Category siRNA lncRNA
Coordinate 2:10878994-10879096(.)
Interaction Sequence AAGGUAGAUACGGUGUAUGAAUCC UCUUUGAUAUAUUGUAUCUACCUU
Interaction Site 1 - 24 81388 - 81411

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network