Basic Information


ANNInter ID ANNInter40245
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-5350 URS00023F9DA5_3702
Category siRNA lncRNA
Coordinate 2:10470444-10471078(+)
Interaction Sequence GGUGAAGAUGGUGAUUGUUGAUA UAUUGACAACCAUUAUUUUCACC
Interaction Site 1 - 23 96371 - 96393

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network