Basic Information


ANNInter ID ANNInter38624
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-4724 URS00023DA2B5_3702
Category siRNA lncRNA
Coordinate 2:7246510-7247977(.) 5:4784155-4827497(+)
Interaction Sequence AAGUUAUGAGAUCGCCAGAAGACC AAUCUUCUGGCGAGCUCAUGACUU
Interaction Site 1 - 24 10450 - 10473

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Translation
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network