Basic Information


ANNInter ID ANNInter37570
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-4385 URS00023E420C_3702
Category siRNA lncRNA
Coordinate 2:5871020-5872667(.)
Interaction Sequence ACGGAACUGGGUUAUAUGGUAGGA UCCUACCAUAUAACCCAGUCCCGU
Interaction Site 1 - 24 61858 - 61881

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network