Basic Information


ANNInter ID ANNInter37258
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-4294 URS000240453A_3702
Category siRNA lncRNA
Coordinate 2:5275953-5276720(.) 2:12383202-12388440(+)
Interaction Sequence AAAGACUGUCAAGGACAACGGGAA UUGUUUUUGUUUUUGACAGUCUUU
Interaction Site 1 - 24 2185 - 2208

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network