Basic Information


ANNInter ID ANNInter36779
Interaction Type siRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-4123 ath_circ_012271
Category siRNA circRNA
Coordinate 2:4242759-4243714(.) 2:7281-40061(.)
Interaction Sequence ACGAGUGACGGACGAACUGGGCGG ACCUCGAGCUCGUCCGUCACUCGU
Interaction Site 1 - 24 6792 - 6815

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network