Basic Information
| ANNInter ID | ANNInter36511 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-4044 | ath_circ_025923 |
| Category | siRNA | circRNA |
| Coordinate | 2:3633671-3634552(.) | 3:15399536-15510372(.) |
| Interaction Sequence | AUGAAAUCU-AGUCUUCUGAAGAGC | GUUCUUCAGAAGACUCAGGUUUCAA |
| Interaction Site | 1 - 24 | 20755 - 20779 |