Basic Information
| ANNInter ID | ANNInter35879 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-3837 | ath_circ_033906 |
| Category | siRNA | circRNA |
| Coordinate | 2:2302151-2307747(.) | 4:15364698-15365532(-) |
| Interaction Sequence | AAUUCUAGGAC-CAAAAACUGUUCU | AGAUCAGUUUUUGAGUCCGAGGAUU |
| Interaction Site | 1 - 24 | 197 - 221 |