Basic Information


ANNInter ID ANNInter35742
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-3780 URS00023DCF72_3702
Category siRNA lncRNA
Coordinate 2:2045874-2046864(.) 1:8981795-9042750(+)
Interaction Sequence AAAGGACCCUCUAUGUAAGUACAU AUGUACUUACACAGAGGGUCCUUU
Interaction Site 1 - 24 29480 - 29503

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network