Basic Information
| ANNInter ID | ANNInter35715 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-3768 | URS0002381FDF_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 2:2016899-2018095(.) | 2:3437319-3534278(+) |
| Interaction Sequence | AAACUCACGUGAUCGCAACA--CAUG | CGUGCCUGUUGCGAUUGUGUGGCUUU |
| Interaction Site | 1 - 24 | 969 - 994 |