Basic Information
| ANNInter ID |
ANNInter35561 |
| Interaction Type |
siRNA - lncRNA |
| Identification Method(s) |
psRNATarget |
Interaction Information
| Type |
ncRNA Interactor 1 |
ncRNA Interactor 2 |
| ncRNA ID |
ath-b10r1-3707 |
URS00023B9DE2_3702 |
| Category |
siRNA |
lncRNA |
| Coordinate |
2:1758136-1759664(.) |
2:17709308-17791283(+) |
| Interaction Sequence |
AGACGAGAGAAGGGAGAGAAAGAC |
UCUUUUCUUUUCUUUUUUUCUUUU |
| Interaction Site |
1 - 24 |
33772 - 33795 |
Additional Information
| Unpaired Energy (UPE) |
NA |
| Inhibition Mode |
Cleavage |
| RNAhybrid MFE |
NA |
| IntaRNA MFE |
NA |
| Degradome Support |
No |
| Allen's Score |
NA |
| Category |
NA |
| Sample IDs |
|