Basic Information


ANNInter ID ANNInter35560
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-3707 URS00023B9DE2_3702
Category siRNA lncRNA
Coordinate 2:1758136-1759664(.) 2:17709308-17791283(+)
Interaction Sequence AGACGAGAGAAGGGAGAGAAAGAC CUUUUCUUUUCUUUUCUUUCGUUU
Interaction Site 1 - 24 14494 - 14517

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network