Basic Information


ANNInter ID ANNInter35556
Interaction Type siRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-3705 ath_circ_026370
Category siRNA circRNA
Coordinate 2:1755914-1756521(+) 3:17389978-17422794(.)
Interaction Sequence AGGAGAAACGGAUAGGUUGAGAAU AUUCUCAACCUAUCCGUUUCUCCU
Interaction Site 1 - 24 13447 - 13470

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network