Basic Information


ANNInter ID ANNInter35337
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-3630 URS00023F5E43_3702
Category siRNA lncRNA
Coordinate 2:1503681-1505870(.) 5:13925970-13988673(+)
Interaction Sequence AAGGGGACACAAGAGAUGAUCACU AAUGAUCAUCUCUUGUGUCCCUUU
Interaction Site 1 - 24 34678 - 34701

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network