Basic Information
| ANNInter ID | ANNInter34531 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-335 | URS0002398F99_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 4:983043-984503(.) | |
| Interaction Sequence | AUGUA-AUGAUGGCUUGUAGAGAGU | UCUCUCCAUGAGCCAUCAUAUACAU |
| Interaction Site | 1 - 24 | 18785 - 18809 |