Basic Information
| ANNInter ID | ANNInter34449 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-3315 | ath_circ_024252 |
| Category | siRNA | circRNA |
| Coordinate | 2:275684-276090(.) | 3:10823591-10994492(.) |
| Interaction Sequence | AGGAGGUUCUGG-CCGAAGCCCGUA | UACGGGUUUCGGUCCAAAACCUCCU |
| Interaction Site | 1 - 24 | 106087 - 106111 |