Basic Information


ANNInter ID ANNInter34417
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-3306 URS0002358C5D_3702
Category siRNA lncRNA
Coordinate 2:240689-241146(.) 3:10805291-10852119(+)
Interaction Sequence AUCUGAUUGUUUGACUUGACACGU ACAUGUCAAGUCAAAUGAUCAGAU
Interaction Site 1 - 24 36313 - 36336

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network