Basic Information


ANNInter ID ANNInter33008
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-2716 URS0000A77615_3702
Category siRNA lncRNA
Coordinate 4:14581781-14582659(.) 2:10542465-10549445(-)
Interaction Sequence AUCCUGAGAAUGUUCUGCAAAAUC GUCUUUGCAGAAUAUUCUCCGGAC
Interaction Site 1 - 24 825 - 848

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network