Basic Information
| ANNInter ID | ANNInter32545 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-2507 | ath_circ_004408 |
| Category | siRNA | circRNA |
| Coordinate | 4:13037857-13038987(.) | 1:9144995-9487204(.) |
| Interaction Sequence | ACGGAAAGAUGU-AUGGGCUUCGGC | GUCGAAGGCCAUGACGUCUUUCCGU |
| Interaction Site | 1 - 24 | 15462 - 15486 |